An observational study in Intestinal Obstruction, Colorectal Cancer and Post-Op Complication, sponsored by Karaganda Medical University. Completed at 1 site in Kazakhstan. Open to participants aged 18 Years and older. Per ClinicalTrials.gov, last updated 2025-01-16.
Sponsored by Karaganda Medical University · Observational
Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. The main component of the development of sepsis in ABO is bacterial translocation (BT). BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs.
Today there are several methods for detecting BT:
The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation (LBP, sCD14-ST) with the detection of microorganism genes (16s rRNA) in mesenteric lymph nodes.
For the early diagnosis of infectious and inflammatory complications, it is necessary to study LBP, sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction, as well as in patients after planned surgical intervention for colon tumors. Based on changes in bacterial translocation biomarkers in the blood serum, it's suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications.
The study materials are blood serum and mesenteric lymph nodes (MLN). Venous blood sampling will be performed 1 hour before surgery, 24 and 72 hours after it. Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator. It will be centrifuged for 20 minutes at 1000 x g, after which the gel completely separates the serum from the clot, forming a tight barrier.ELISA Kit for Lipopolysaccharide Binding Protein (LBP, Human) and for Presepsin (sCD14-ST, Human), from Cloud-Clone Corp. will be used to determine any presence of LBP and sCD14-ST. The analysis will be performed according to the manufacturer's instructions for an ELISA EVOLIS robotic system from BioRad.
The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen. MLN will be placed in a sterile tube without any fillers. The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific, USA, in accordance with the manufacturer's instructions. The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers (U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC).
During the implementation, the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company (NJSC) "Karaganda Medical University" will be used.
This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP09260597).
104 studies on the registry are indexed under Intestinal Obstruction; 15 are open to participants now.
This study's enrollment of 150 is above the median of 107 across 40 observational studies indexed under Intestinal Obstruction.
Browse Intestinal Obstruction studies →Karaganda Medical University is the lead sponsor of 12 studies on the registry; 1 is open to participants now.
Counted across the registry records on this site, refreshed daily.
Patients with malignant and benign acute bowel obstruction, colorectal cancer patients without acute bowel obstruction (planned operations) aged from 18, who are expected to undergo surgical treatment for this pathology.
Go through the criteria one by one — yes, no or not sure — and take the list to your doctor or the study team. Kept in this browser only.
Exclusion Criteria:
Underlined terms in the criteria open these too. Explained by clinicaltrials.gg, not part of the registry record. The study team decides who can take part.
The human immunodeficiency virus, which weakens the immune system.
Many studies now accept people whose HIV is controlled on treatment, judged by the viral load and the CD4 count. Check the limits this study sets.
HIV
The human immunodeficiency virus, which weakens the immune system.
Many studies now accept people whose HIV is controlled on treatment, judged by the viral load and the CD4 count. Check the limits this study sets.
Explained by clinicaltrials.gg, not part of the registry record. The study team decides who can take part.
60 patients with malignant acute bowel obstruction
Diagnostic Test: LBP · Diagnostic Test: sCD14-ST · Diagnostic Test: 16s rRNA
60 colorectal cancer patients without acute bowel obstruction (planned operations)
Diagnostic Test: LBP · Diagnostic Test: sCD14-ST · Diagnostic Test: 16s rRNA
30 patients with benign acute bowel obstruction
Diagnostic Test: LBP · Diagnostic Test: sCD14-ST · Diagnostic Test: 16s rRNA
Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method.
Change in Number of Participants With Post-operative Infectious and Inflammatory Complications
Аny infectious and inflammatory complications in post-operative period (wound suppuration, anastomotic leak, аbdominal abscesses, peritonitis, sepsis, etc.)
Time frame: Once (if any complication occurs during hospitalization - from 7 to 28 days)
LBP Level in Serum Blood
LBP levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.
Time frame: 1 hour before surgery, 72 hours after surgery
sCD14-ST Level in Serum Blood
sCD14-ST levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.
Time frame: 1 hour before surgery, 72 hours after surgery
16s rRNA in Mesenteric Lymph Nodes
Presence or absence of 16s rRNA in mesenteric lymph nodes will be compared between groups/subgroups.
Time frame: Once (MLN sampling in sterile conditions during surgery)
| Milestone | CRC Without ABO (Control) | Malignant ABO | Benign ABO |
|---|---|---|---|
| Started | 60 | 60 | 30 |
| Completed | 60 | 60 | 30 |
| Not completed | 0 | 0 | 0 |
Аny infectious and inflammatory complications in post-operative period (wound suppuration, anastomotic leak, аbdominal abscesses, peritonitis, sepsis, etc.)
| Participants | Malignant ABO | CRC Without ABO (Control) | Benign ABO |
|---|---|---|---|
| - Post-operative infectious complications | 43 | 47 | 25 |
| + Post-operative infectious complications | 17 | 13 | 5 |
LBP levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.
| ng/mL | Malignant ABO | CRC Without ABO (Control) | Benign ABO |
|---|---|---|---|
| LBP before surgery (ng/mL) | 1164.4 (826.4 to 1509.7) | 971.4 (816.9 to 1277.5) | 1015.1 (486.4 to 1543.3) |
| LBP on the 3rd day after surgery (ng/mL) | 890.9 (703.2 to 1213.7) | 897.9 (712.5 to 1220.9) | 1180.0 (687.1 to 1392.3) |
sCD14-ST levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.
| pg/mL | Malignant ABO | CRC Without ABO (Control) | Benign ABO |
|---|---|---|---|
| sCD14-ST before surgery (pg/mL) | 571.7 (342.5 to 990) | 245.7 (167.9 to 403.4) | 485.2 (277.9 to 771.0) |
| sCD14-ST on day 3 after surgery (pg/mL) | 527.8 (305.0 to 732.5) | 227.6 (163.5 to 419.8) | 386.5 (185.4 to 957.0) |
Presence or absence of 16s rRNA in mesenteric lymph nodes will be compared between groups/subgroups.
| Count of Participants | Malignant ABO | CRC Without ABO (Control) | Benign ABO |
|---|---|---|---|
| Presence of 16s rRNA | 15 | 16 | 0 |
| Absence of 16s rRNA | 45 | 44 | 5 |
Collected over During hospitalization (from 7 to 28 days). Non-serious events are listed at a 0% frequency threshold.
| Group | Deaths | Serious | Other |
|---|---|---|---|
| Malignant ABO | 12/60 (20%) | 0/60 (0%) | 0/60 (0%) |
| CRC Without ABO (Control) | 1/60 (1.7%) | 0/60 (0%) | 0/60 (0%) |
| Benign ABO | 2/30 (6.7%) | 0/30 (0%) | 0/30 (0%) |
The acceptance criteria are as follows: patients undergoing planned surgical intervention for colorectal tumor, patients with ABO of tumor and non-tumor genesis over 18 years of age. The exclusion criteria included: age under 18 years, pregnant women, patients with paralytic/dynamic ABO, patients with HIV infection, liver cirrhosis as well as those patients with an ongoing infectious process due to another pathology.
| Age, Categorical(Participants) | Malignant ABO | CRC Without ABO (Control) | Benign ABO | Total |
|---|---|---|---|---|
| <=18 years | 0 | 0 | 0 | 0 |
| Between 18 and 65 years | 26 | 26 | 20 | 72 |
| >=65 years | 34 | 34 | 10 | 78 |
| Age, Continuous(years) | Malignant ABO | CRC Without ABO (Control) | Benign ABO | Total |
|---|---|---|---|---|
| Median | 67.5 (58.5 to 78) | 66.5 (54 to 73) | 59.5 (43 to 70) | 66 (56 to 73.5) |
| Sex: Female, Male(Participants) | Malignant ABO | CRC Without ABO (Control) | Benign ABO | Total |
|---|---|---|---|---|
| Female | 39 | 26 | 15 | 80 |
| Male | 21 | 34 | 15 | 70 |
| Race and Ethnicity Not Collected(Participants) | Malignant ABO | CRC Without ABO (Control) | Benign ABO | Total |
|---|---|---|---|---|
| Count of participants | — | — | — | 0 |
| Region of Enrollment(participants) | Malignant ABO | CRC Without ABO (Control) | Benign ABO | Total |
|---|---|---|---|---|
| Kazakhstan | 60 | 60 | 30 | 150 |
| Stage of the tumor process(Participants) | Malignant ABO | CRC Without ABO (Control) | Benign ABO | Total |
|---|---|---|---|---|
| I | 2 | 10 | 0 | 12 |
| II | 20 | 26 | 0 | 46 |
| III | 14 | 17 | 0 | 31 |
| IV | 24 | 7 | 0 | 31 |
PDFs hosted by the registry, ClinicalTrials.gov.
Plan to share: No
Ran from Mar 2021 to primary completion in Oct 2023, 31 months.
Results were first posted in Jan 2025, 1 year 2 months after primary completion.
How these figures are worked out, and which studies are left out of them.
This study is completed, as verified in Nov 2024. You cannot join it, but the record below documents what was studied.
Get an email when the registry record changes — status, dates, results — or when someone posts here.
Sign in to followQuestions and observations about this study, from anyone following it. Not medical advice, and not a channel to the study team — their contact details are on the registry record.
Sign in to join the discussion. Reading takes no account; posting does. You choose a display name, and a pseudonym is the default.
Nothing here yet. If you are running this trial, taking part in it, or weighing whether to, this is the place to say so.
Karaganda Medical University